Page 82 - 83_01

complication (1). In fact, neuroinflammation induced by
the diabetic milieu is a central contributing factor in DR
progression (2). Similarly to other neurodegenerative
diseases, DR exhibits characteristics of low-grade chronic
inflammation (3) in which changes in retinal expression of
inflammatory mediators occur in concert with functional
changes in retinal permeability and apoptosis (4, 5). It has
been proposed that in neuroinflammation microglia
becomes activated and produce inflammatory mediators.
Microglia, serving as resident macrophages of the retina,
has multiple functional states and carries out diverse
functions. Capable of rapid dynamism and motility,
microglial cells synthesize and release cytokines,
chemokines, neurotrophic factors, and neurotransmitters
that interact with multiple cell types in the central nervous mice remain unknown. The aim of this study is to examine
system (CNS) and exert cytotoxic, cytoprotective and
scavenger effects depending on the tissue context (6).
Retinal diseases such as proliferative DR and diabetic
macular edema are often accompanied by
macrophage/microglia cells activation (7, 8).
The existence of a continuum of polarization states
in macrophages results from the integration of the
intracellular signals triggered by their surrounding milieu
(9, 10). M1, or classically-activated macrophages, mainly
secrete pro-inflammatory cytokines such as TNFa, IL12,
IL23, IL1ß, IL6 and chemotactic factors and are involved
in the pro-inflammatory response. By contrast,
alternatively-activated macrophages (M2) express high
levels of arginase-1 and IL10, but low levels of IL12 and
IL23 and are usually induced by the anti-inflammatory
cytokines IL4 and IL13 (11).
DR exhibits many features of chronic inflammation
such as increased NO production and release of pro-
inflammatory cytokines (12). In fact, TNFa, IL1ß, IL-8
and MCP-1 have been found elevated in the vitreous of
diabetic patients (13, 14). Recently, the inflammasome
complex, which cleaves pro-IL1ß into secreted IL1ß via
caspase-1, has been found activated in retinal pigment
epithelial cells cultured under high glucose levels (15), but glutamine (Gibco, Carlsbad, California, USA). Cells were
its modulation in the retina during DR has not yet been
explored. In this scenario, microglia may underline its
different functional properties and, therefore, targeting its ng/ml) with or without a mixture of IL4/IL13 (20 ng/ml
polarization is a promising approach for the treatment of
CNS diseases (16) including DR.
Among therapies targeting pro-inflammatory
mediators, the natural compounds have emerged as an
alternative to chemical drugs. Iminosugar glycosyl
hydrolase inhibitors such as 1-deoxynojirimycin and
castanospermine have a strong potential in therapies for
cancer, viral infections, diabetes and glycosphingolipid
storage disorders (17, 18). In particular, sp2-iminosugar-
type bicyclic nojirimycin analogues with an alpha-
82 @Real Academia Nacional de Farmacia. Spain
Ana I. Arroba, Ángela M. Valverde
configured N-, S-, or C-linked pseudoanomeric group have
been previously evaluated as antitumor agents (18).
However, their effects in inflammatory processes during
DR remain to be elucidated.
In recent years the C57BL/KsJ-db/db mouse model has
been extensively used to investigate the pathogenesis of
DR (19) since reproduce the neurodegenerative process
that occur in the human diabetic retina (20). However, the
events that occur in the retina at early stages of DR
previous to neurodegeneration, and, in particular the role
of microglia associated to neuroinflammation in db/db
the polarization of microglia during the early stages of DR
and its modulation by a sp2-iminosugar-type bicyclic
nojirimycin analogue.
2. METHODS
2.1. Reagents and drugs
Fetal bovine serum (FBS) and culture media were
obtained from Invitrogen (Grand Island, NY, USA).
Bovine serum albumin (BSA) and bacterial
lipopolysaccharide (LPS) were purchased from Sigma-
Aldrich (St Louis, MO, USA). IL4 and IL13 were
purchased from Preprotech (London, UK). Bradford
reagent, acrylamide, immunoblot PVDF membranes and
chemioluminiscent HRP Substrate were purchased from
Bio-Rad (Madrid, Spain).
2.2. Cell culture
Mouse microglia Bv-2 cell line was provided by Dr.
M.L. Nieto (CSIC, Spain). Bv-2 cells were cultured at
37°C in a humidified atmosphere with 5 % CO2 in RPMI
supplemented with 10 % (v/v) heat-inactivated FBS, 1 %
(v/v) penicillin/streptomycin (Sigma) and 2 mM L-
grown up to 70 % confluence, washed with PBS and
further stimulated in serum-free medium with LPS (200
each; M2) or R-DS-ONJ (compound C5) for several time-
periods. For mouse cell line authentication, genomic DNA
was isolated from Bv-2 cells and analyzed by PCR as
described (21). Primer sequences used for amplification of
mouse STR were: Forward (6-7)
5´AGTCCACCCAGTGCATTCTC 3´; Reverse (6-7)
5´CATGTGGCTGGTATGCTGTT 3´; Forward (15-3) 5´
TCTGGGCGTGTCTGTCATAA 3´: Reverse (15-3) 5´
TTCTCAGGGAGGAGTGTGCT 3´.