Page 82 - 83_01
P. 82
complication (1). In fact, neuroinflammation induced by Ana I. Arroba, Ángela M. Valverde
the diabetic milieu is a central contributing factor in DR
progression (2). Similarly to other neurodegenerative configured N-, S-, or C-linked pseudoanomeric group have
diseases, DR exhibits characteristics of low-grade chronic been previously evaluated as antitumor agents (18).
inflammation (3) in which changes in retinal expression of However, their effects in inflammatory processes during
inflammatory mediators occur in concert with functional DR remain to be elucidated.
changes in retinal permeability and apoptosis (4, 5). It has
been proposed that in neuroinflammation microglia In recent years the C57BL/KsJ-db/db mouse model has
becomes activated and produce inflammatory mediators. been extensively used to investigate the pathogenesis of
Microglia, serving as resident macrophages of the retina, DR (19) since reproduce the neurodegenerative process
has multiple functional states and carries out diverse that occur in the human diabetic retina (20). However, the
functions. Capable of rapid dynamism and motility, events that occur in the retina at early stages of DR
microglial cells synthesize and release cytokines, previous to neurodegeneration, and, in particular the role
chemokines, neurotrophic factors, and neurotransmitters of microglia associated to neuroinflammation in db/db
that interact with multiple cell types in the central nervous mice remain unknown. The aim of this study is to examine
system (CNS) and exert cytotoxic, cytoprotective and the polarization of microglia during the early stages of DR
scavenger effects depending on the tissue context (6). and its modulation by a sp2-iminosugar-type bicyclic
Retinal diseases such as proliferative DR and diabetic nojirimycin analogue.
macular edema are often accompanied by
macrophage/microglia cells activation (7, 8). 2. METHODS
The existence of a continuum of polarization states 2.1. Reagents and drugs
in macrophages results from the integration of the
intracellular signals triggered by their surrounding milieu Fetal bovine serum (FBS) and culture media were
(9, 10). M1, or classically-activated macrophages, mainly obtained from Invitrogen (Grand Island, NY, USA).
secrete pro-inflammatory cytokines such as TNFa, IL12, Bovine serum albumin (BSA) and bacterial
IL23, IL1ß, IL6 and chemotactic factors and are involved lipopolysaccharide (LPS) were purchased from Sigma-
in the pro-inflammatory response. By contrast, Aldrich (St Louis, MO, USA). IL4 and IL13 were
alternatively-activated macrophages (M2) express high purchased from Preprotech (London, UK). Bradford
levels of arginase-1 and IL10, but low levels of IL12 and reagent, acrylamide, immunoblot PVDF membranes and
IL23 and are usually induced by the anti-inflammatory chemioluminiscent HRP Substrate were purchased from
cytokines IL4 and IL13 (11). Bio-Rad (Madrid, Spain).
DR exhibits many features of chronic inflammation 2.2. Cell culture
such as increased NO production and release of pro-
inflammatory cytokines (12). In fact, TNFa, IL1ß, IL-8 Mouse microglia Bv-2 cell line was provided by Dr.
and MCP-1 have been found elevated in the vitreous of M.L. Nieto (CSIC, Spain). Bv-2 cells were cultured at
diabetic patients (13, 14). Recently, the inflammasome 37°C in a humidified atmosphere with 5 % CO2 in RPMI
complex, which cleaves pro-IL1ß into secreted IL1ß via supplemented with 10 % (v/v) heat-inactivated FBS, 1 %
caspase-1, has been found activated in retinal pigment (v/v) penicillin/streptomycin (Sigma) and 2 mM L-
epithelial cells cultured under high glucose levels (15), but glutamine (Gibco, Carlsbad, California, USA). Cells were
its modulation in the retina during DR has not yet been grown up to 70 % confluence, washed with PBS and
explored. In this scenario, microglia may underline its further stimulated in serum-free medium with LPS (200
different functional properties and, therefore, targeting its ng/ml) with or without a mixture of IL4/IL13 (20 ng/ml
polarization is a promising approach for the treatment of each; M2) or R-DS-ONJ (compound C5) for several time-
CNS diseases (16) including DR. periods. For mouse cell line authentication, genomic DNA
was isolated from Bv-2 cells and analyzed by PCR as
Among therapies targeting pro-inflammatory described (21). Primer sequences used for amplification of
mediators, the natural compounds have emerged as an mouse STR were: Forward (6-7)
alternative to chemical drugs. Iminosugar glycosyl 5´AGTCCACCCAGTGCATTCTC 3´; Reverse (6-7)
hydrolase inhibitors such as 1-deoxynojirimycin and 5´CATGTGGCTGGTATGCTGTT 3´; Forward (15-3) 5´
castanospermine have a strong potential in therapies for TCTGGGCGTGTCTGTCATAA 3´: Reverse (15-3) 5´
cancer, viral infections, diabetes and glycosphingolipid TTCTCAGGGAGGAGTGTGCT 3´.
storage disorders (17, 18). In particular, sp2-iminosugar-
type bicyclic nojirimycin analogues with an alpha-
82 @Real Academia Nacional de Farmacia. Spain

